https://cryptome.org/2016/08/guccifer2-dccc-16-0812.zip
And in other news, Pres daughter can smoke pot but the FDA/DEA military-industrials say, no medical use.
Donald needs to disband them.
14 August 2016
11 August 2016
Wahabi Salafists for Trump
Dear Donald Trump,
Please specify Wahabi Salafists as the brand of Islam that is causing problems. These are old-school "ultra orthodox" fundies. They are the problem.
The Saudis (Sunnis) are favorable to Wahabis. The Saudis fund Ms. Clinton.
Specify this extremist sliver of Islam and you win everyone but the Saudis and similar troglodytes.
Please specify Wahabi Salafists as the brand of Islam that is causing problems. These are old-school "ultra orthodox" fundies. They are the problem.
The Saudis (Sunnis) are favorable to Wahabis. The Saudis fund Ms. Clinton.
Specify this extremist sliver of Islam and you win everyone but the Saudis and similar troglodytes.
09 August 2016
Michael Phelps
Michael Phelps just won gold.
Fucking stoner. Bong hits and he still is the best swimmer in the universe. Doper. Wastecase. Head. Loser.
NOT.
Motivated intelligent athlete whose fondness for cannabis has hurt him exactly ZERO aside from cultural feedback ie sponsors.
However, consider the Phelps brand in Colorado etc.
I personally have 4 patents, make $135K, and have smoked many kilos of grass followed by grams of concentrates.
I loathe the stupid proles and like Maynard welcome the apocalypse.
Zika means everyone is as stupid as the politicians. A Vonnegut universe. Awesome.
Tool. King Crimson. Rush. Tom Waits. Bach. Laurie Anderson.
Iggy Pop. Kronos Quartet. Lou Reed. Smashing Pumpkins.
Trump because why not, and empires implode a lot faster now.
Einsturzende Neubauten.
Fucking stoner. Bong hits and he still is the best swimmer in the universe. Doper. Wastecase. Head. Loser.
NOT.
Motivated intelligent athlete whose fondness for cannabis has hurt him exactly ZERO aside from cultural feedback ie sponsors.
However, consider the Phelps brand in Colorado etc.
I personally have 4 patents, make $135K, and have smoked many kilos of grass followed by grams of concentrates.
I loathe the stupid proles and like Maynard welcome the apocalypse.
Zika means everyone is as stupid as the politicians. A Vonnegut universe. Awesome.
Tool. King Crimson. Rush. Tom Waits. Bach. Laurie Anderson.
Iggy Pop. Kronos Quartet. Lou Reed. Smashing Pumpkins.
Trump because why not, and empires implode a lot faster now.
Einsturzende Neubauten.
28 June 2016
s attaturk ottoman goatfuckers ergodon
LOL attaturk ottoman goatfuckers ergodon
bangie bangie
muslim islamic pandering hemorrhoids
LOL Ergodan goat pussy
LOL ISIS DRONE into ISTANBUL
LOL CLINTON CRUISE MISSILE BLOWJOB MONICA ALTOIDS
LOL Hillary Wellesley
LOL Hillary Weiner
LOL Bill Weiner
LOL Hillary Huma
LOL puss puss hillary altoids puss puss
bangie bangie
muslim islamic pandering hemorrhoids
LOL Ergodan goat pussy
LOL ISIS DRONE into ISTANBUL
LOL CLINTON CRUISE MISSILE BLOWJOB MONICA ALTOIDS
LOL Hillary Wellesley
LOL Hillary Weiner
LOL Bill Weiner
LOL Hillary Huma
LOL puss puss hillary altoids puss puss
21 June 2016
corporate pandering (HR SJW?)
21 June 2016
31 Technology Drive, Irvine, CA
Fagflag flying next to US flag. Never seen that before. At a JnJ Medical Device Campus. After Orlando.
And printed flyers inviting employees to a sodomite (LBGTQwhatever, ie, homosexual, perverted, or mentally ill) meetup, compleat with "straight allies" [sic] In plain sight, everyone forced to read them on entering a building.
Wonder how 3-way sodomite or 1:M mormon polygamy or generic N:M polyamory would play out. There are utah employees after all, and muslims. Problem, CSS?
During Ferguson chimpout: posters with a negro employee with some comment about "culture". I thought that was accidental at the time.
In between: break room posters with mongoloid retards and amputees.
WTF these millenial corporate pussy HR need serious hanging.
Meanwhile they charge 10x possible price for medical devices.
Now that I think about it, I haven't seen the truck with the anti-BO, pro-military etc bumper stickers on it recently. Even though JnJ likes to hire ex-mil. And other serious conformists. Mediocrity central: talk the lingo and dress fancy. Parasitism. Lip service to patients but outsourced Indian engineering and hazardous scheduling (cut the testing, we have to meet schedule!) mean shareholder/exec is primary.
The Credo hotline is a trap.
Rome didn't fall in a day, but things happen faster now.
@nero save us.
31 Technology Drive, Irvine, CA
Fagflag flying next to US flag. Never seen that before. At a JnJ Medical Device Campus. After Orlando.
And printed flyers inviting employees to a sodomite (LBGTQwhatever, ie, homosexual, perverted, or mentally ill) meetup, compleat with "straight allies" [sic] In plain sight, everyone forced to read them on entering a building.
Wonder how 3-way sodomite or 1:M mormon polygamy or generic N:M polyamory would play out. There are utah employees after all, and muslims. Problem, CSS?
During Ferguson chimpout: posters with a negro employee with some comment about "culture". I thought that was accidental at the time.
In between: break room posters with mongoloid retards and amputees.
WTF these millenial corporate pussy HR need serious hanging.
Meanwhile they charge 10x possible price for medical devices.
Now that I think about it, I haven't seen the truck with the anti-BO, pro-military etc bumper stickers on it recently. Even though JnJ likes to hire ex-mil. And other serious conformists. Mediocrity central: talk the lingo and dress fancy. Parasitism. Lip service to patients but outsourced Indian engineering and hazardous scheduling (cut the testing, we have to meet schedule!) mean shareholder/exec is primary.
The Credo hotline is a trap.
Rome didn't fall in a day, but things happen faster now.
@nero save us.
20 June 2016
there has never been the child of a BLACK WOMAN in the white house.alicia garza-
Even still, I find it really unfortunate that the first black president that this country has ever had spends so much time chastising black people
LOL niggy there has never been the child of a BLACK WOMAN in the white house.
He's the second Irish president.
LOL you pwned
http://www.huffingtonpost.com/entry/alicia-garza-black-lives-matter_us_5767fb71e4b015db1bc9dbd8
LOL niggy there has never been the child of a BLACK WOMAN in the white house.
He's the second Irish president.
LOL you pwned
http://www.huffingtonpost.com/entry/alicia-garza-black-lives-matter_us_5767fb71e4b015db1bc9dbd8
The Negro Family
https://web.stanford.edu/~mrosenfe/Moynihan's%20The%20Negro%20Family.pdf
Note that bastards are now at 50% instead of 25%
Note that bastards are now at 50% instead of 25%
Alicia Garza drinking game
Every time she says "black" you have to drink:
I have a lot of respect for President Obama, and while I deeply disagree with some of his actions or lack of action on issues I care about, I still recognize the significance of the first black presidency and the challenges that come with that. Even still, I find it really unfortunate that the first black president that this country has ever had spends so much time chastising black people who have done more in three years to place structural racism front and center than he himself has done in eight years of being president. It’s fascinating to watch President Obama be subjected to blistering prejudice and racism from members of Congress and their supporters, and yet to then watch him chastise black activists and organizers for not wanting to play their version of politics. It’s not a coincidence that an upsurge in a fairly nascent black freedom movement emerges during the administration of the first black president this country has ever had.
http://www.huffingtonpost.com/entry/alicia-garza-black-lives-matter_us_5767fb71e4b015db1bc9dbd8
Serious coonin
Why NYC deserved 911
senator schumer
Hillary clinton
Gulliani
Bloomberg
And the list goes on. I'm glad I got out of the state and never stayed in NYC.
20 kilotons, baby, clean it. Statist nanny scum.
Bring rope, I'll find a tree.
Seriously. We have Boxer and Feinstein, and they need termination too.
It will be hard to explain to the future how we tolerated them.
Hillary clinton
Gulliani
Bloomberg
And the list goes on. I'm glad I got out of the state and never stayed in NYC.
20 kilotons, baby, clean it. Statist nanny scum.
Bring rope, I'll find a tree.
Seriously. We have Boxer and Feinstein, and they need termination too.
It will be hard to explain to the future how we tolerated them.
Alicia Garza goes to liberia
Alicia Garza, a BlackJiveChatter co-founder, today declared that she is taking a one way flight to Liberia, the historic resettlement nations for the sub-saharans sold into slavery by their families. She admits she has no skills, either in America or Afrika, such as farming, but expects that Afrika will take care of her.
parasite talk
Black Lives Matter is doing the work of engaging our communities around the issues that are important to us
http://www.huffingtonpost.com/entry/alicia-garza-black-lives-matter_us_5767fb71e4b015db1bc9dbd8
"doing the work" ---collecting welfare while being ungrateful and rude
"engaging our communities" ---agitating the negroes
"the issues" ---the problems
Many of our people are engaged in important work to help our communities understand the root cause of the violence that we experience
"our people"
"engaged"
"important work"
"our communities"
root cause = violent impulsive stupid tribe
http://www.huffingtonpost.com/entry/alicia-garza-black-lives-matter_us_5767fb71e4b015db1bc9dbd8
"doing the work" ---collecting welfare while being ungrateful and rude
"engaging our communities" ---agitating the negroes
"the issues" ---the problems
Many of our people are engaged in important work to help our communities understand the root cause of the violence that we experience
"our people"
"engaged"
"important work"
"our communities"
root cause = violent impulsive stupid tribe
niggas need coders
We need the best and the brightest thinkers, strategists, coders, surveillance experts, tech geeks and disruptors
http://www.huffingtonpost.com/entry/alicia-garza-black-lives-matter_us_5767fb71e4b015db1bc9dbd8
Parasitic negroes... write your own code
http://www.huffingtonpost.com/entry/alicia-garza-black-lives-matter_us_5767fb71e4b015db1bc9dbd8
Parasitic negroes... write your own code
more cowbell
http://www.metalinjection.net/video/heres-pro-shot-footage-of-rammsteins-new-song-ramm-4
Burn ferguson now
about 16,000 of the 21,000 residents of Ferguson, Mo., are subject to arrest warrants.
http://www.nytimes.com/2016/06/21/us/supreme-court-says-police-may-use-evidence-found-after-illegal-stops.html?action=click&contentCollection=Politics&module=Trending&version=Full®ion=Marginalia&pgtype=article
Airstrike now
http://www.nytimes.com/2016/06/21/us/supreme-court-says-police-may-use-evidence-found-after-illegal-stops.html?action=click&contentCollection=Politics&module=Trending&version=Full®ion=Marginalia&pgtype=article
Airstrike now
12 June 2016
la dodged a boston-marathon.
http://www.nytimes.com/live/orlando-nightclub-shooting-live-updates/hamilton-to-drop-muskets/
Wow did LA just dodge a bullet (LOL).
Of course, the NSA/CIA/FBI traced down a lot of these "not sufficient evidence" guys after the Orlando fagshoot. So the "hey man, can I check your car" is typical 2016 orwelllian fakery. You don't admit your mil-intel leads; you give a plausible other interpretation, their tail light was out. And the "jury" believes it.
cryptome.org
Wow did LA just dodge a bullet (LOL).
Of course, the NSA/CIA/FBI traced down a lot of these "not sufficient evidence" guys after the Orlando fagshoot. So the "hey man, can I check your car" is typical 2016 orwelllian fakery. You don't admit your mil-intel leads; you give a plausible other interpretation, their tail light was out. And the "jury" believes it.
cryptome.org
31 May 2016
06 May 2016
01 May 2016
Who fellates McCain better, Boehner or Graham
Who fellates McCain better, Boehner or Graham
http://www.cbsnews.com/news/lindsey-graham-donald-trump-presidency-will-lead-to-another-911/
Hang 'em high
http://www.cbsnews.com/news/lindsey-graham-donald-trump-presidency-will-lead-to-another-911/
Hang 'em high
27 April 2016
23 April 2016
HST moment, black privilege
What was I thinking? I was just going to write it. Damn.
Hippie chicks putting flowers in rifle barrels.
Nice.
Negroes blocking political conferences, and traffic, including ambulances.
Nice.
We don't want race war.
We don't want special privileges.
We don't want different standards.
Then all's cool with us. Equal is equal.
Unless there's black privilege.
19 April 2016
Trump vs. Mexico is brilliant
Trump *can* shut down money xfers to mexico.
And this will devestate the mayans.
As a result, they *will* pay for or build a wall, just to keep sucking off the US teat.
Eventually we will take Baja, then the rest of the mexis to counter their cartels. And we will liberate them, and make them citizens, and base our armies there, not in Japan or Germany. And we will get mexi oil, vegetables, and labor, and they will love us for it.
TRUMP TRUMP TRUMP TRUMP TRUMP TRUMP TRUMP TRUMP
And this will devestate the mayans.
As a result, they *will* pay for or build a wall, just to keep sucking off the US teat.
Eventually we will take Baja, then the rest of the mexis to counter their cartels. And we will liberate them, and make them citizens, and base our armies there, not in Japan or Germany. And we will get mexi oil, vegetables, and labor, and they will love us for it.
TRUMP TRUMP TRUMP TRUMP TRUMP TRUMP TRUMP TRUMP
Hilary "wins" NY
LOL, an arkansas lawer bitch, wellesley schooled, who splayed for the gov, then pres, then moved to *harlem* NY of all places, wins the corrupt state of NY. Rome is smiling.
I grew up in upstate.
Damn it needs nuking, at least, downstate. Wipe Harlem, NYC, and especially hillary and her ilk.
Or, kowtow. A thousand years of domination.
Or, one bullet, one noose, one vote.
LOL her competition is a self-proclaimed socialist.
Yet, she is an undocumented communist.
LOL, lock 'n load. Prepare your Trumps now.
Trumpiverse coming, trumpadelic, time to clean hous, drain the swamp, send the senators' whore wives back to where they came from.
Especially, Hillary.
Trump/Palin/Lewinsky 2016
I grew up in upstate.
Damn it needs nuking, at least, downstate. Wipe Harlem, NYC, and especially hillary and her ilk.
Or, kowtow. A thousand years of domination.
Or, one bullet, one noose, one vote.
LOL her competition is a self-proclaimed socialist.
Yet, she is an undocumented communist.
LOL, lock 'n load. Prepare your Trumps now.
Trumpiverse coming, trumpadelic, time to clean hous, drain the swamp, send the senators' whore wives back to where they came from.
Especially, Hillary.
Trump/Palin/Lewinsky 2016
Utah leaders declare religion a hazard to young minds
https://www.washingtonpost.com/national/religion/utah-leaders-call-pornography-a-plague-damaging-young-minds/2016/04/19/e77db3d0-067d-11e6-bfed-ef65dff5970d_story.html
Belief in supernatural things, polygamy, supernatural underwear, no coffee, freakazoids.
Pervs.
Utah approves supernaturalist pervs.
Nice.
Belief in supernatural things, polygamy, supernatural underwear, no coffee, freakazoids.
Pervs.
Utah approves supernaturalist pervs.
Nice.
Super Power run over peon
http://www.independent.co.uk/news/world/americas/samantha-power-americas-un-ambassadors-60mph-motorcade-kills-boy-in-cameroon-a6990401.html
S Power (get it?) runs over turd world niggy.
LOL
S Power (get it?) runs over turd world niggy.
LOL
17 April 2016
Hilary is the new House Nigger
Hilary is the new House Nigger
Owned, controlled, content.
Employed by zionists, and the M.I. complex. And the socialist-welfare complex.
Hilary is what you want if you enjoyed Obama.
More dysfunctional families, with the clinton advantage of Dynasty (tm).
Owned, controlled, content.
Employed by zionists, and the M.I. complex. And the socialist-welfare complex.
Hilary is what you want if you enjoyed Obama.
More dysfunctional families, with the clinton advantage of Dynasty (tm).
Saudi Faisal vs Zappa
Hey goatfucker Faisal,
When you come here for surgery, you'd best dress as Zappa
(SHEIK YUR BOOTY) because you might have, um, *complications*
as Frank would say.
Penguins in bondage, baby.
We will feed your corpse to pigs or dogs, your royal choice.
Also, your wife sucks my Boeing.
When you come here for surgery, you'd best dress as Zappa
(SHEIK YUR BOOTY) because you might have, um, *complications*
as Frank would say.
Penguins in bondage, baby.
We will feed your corpse to pigs or dogs, your royal choice.
Also, your wife sucks my Boeing.
Saudi goatfuckers need regime change
The "kings" in the oil sands, the sauds, need regime change.
Ship them to some island, put in a real government.
One that doens't fund Wahhabi or Salafist terrorists.
One that enforces the US Constitution and Bill of Rights.
About three dozen SOF could take these camelmonkeys down.
Time is NOW.
Yo Kings & Princes: if you resign now, Donald may spare your lives.
Else, you will face your population. A bayonet up the ass, like your Libyan buds.
Faisal, bring it on, when you remove your lips from your favorite camel (or Ergodan's) weenie.
Bring it, and start digging your grave.
Ship them to some island, put in a real government.
One that doens't fund Wahhabi or Salafist terrorists.
One that enforces the US Constitution and Bill of Rights.
About three dozen SOF could take these camelmonkeys down.
Time is NOW.
Yo Kings & Princes: if you resign now, Donald may spare your lives.
Else, you will face your population. A bayonet up the ass, like your Libyan buds.
Faisal, bring it on, when you remove your lips from your favorite camel (or Ergodan's) weenie.
Bring it, and start digging your grave.
16 April 2016
Zuckerberg needs to die
Facebook is a facist tool.
Facebook is trying to influence US politics.
Zuckerberg wants to outsource you.
http://www.dailymail.co.uk/news/article-3543328/Facebook-employees-ask-CEO-Mark-Zuckerberg-help-derail-Trump-s-presidency-bid.html
What crap Zuckerberg has unleashed. Needs hanging.
Facebook is trying to influence US politics.
Zuckerberg wants to outsource you.
http://www.dailymail.co.uk/news/article-3543328/Facebook-employees-ask-CEO-Mark-Zuckerberg-help-derail-Trump-s-presidency-bid.html
What crap Zuckerberg has unleashed. Needs hanging.
Arianna vs. Donald
http://www.huffingtonpost.com/entry/arianna-huffington-bill-maher-show_us_5711e947e4b06f35cb6fbde0
Ariannas sole qualifications: she slept with a homosexual politician.
Ariannas sole qualifications: she slept with a homosexual politician.
11 April 2016
Cruz fornicates in Irvine
http://ktla.com/2016/04/11/gop-presidential-hopeful-ted-cruz-hosts-rally-in-irvine/
Cruz is amusing as a religious fanatic and pseudo-conservative.
TRUMP is the man, he does not follow the PC.
Cruz needs to go back to Cuba, or where-ever. Trump can clean this sh*t up.
LOL, another lib for DJT.
Cruz is amusing as a religious fanatic and pseudo-conservative.
TRUMP is the man, he does not follow the PC.
Cruz needs to go back to Cuba, or where-ever. Trump can clean this sh*t up.
LOL, another lib for DJT.
Trump vs. scum
Scum:
Lindsey Graham
John McCain
Boxer
Feinstein
"Altoids" Clinton
Needing killing.
All traitors. All zionist puppets. Traitors.
Lindsey Graham
John McCain
Boxer
Feinstein
"Altoids" Clinton
Needing killing.
All traitors. All zionist puppets. Traitors.
Trump 2016
http://www.washingtonexaminer.com/article/2588172
Trump or Hilary? Or Cruz? Or Sanders?
Seriously?
Do you want a civil war?
Trump or Hilary? Or Cruz? Or Sanders?
Seriously?
Do you want a civil war?
Republican GOP fail
Replied Haugland: “Political parties choose their nominees, not the voters.”
http://www.politico.com/magazine/story/2016/04/gop-2016-paul-ryan-cleveland-213803
so much for democracy.
which is mob rule.
but now we have back-room sleeze
How's that gonna work out, GOP?
http://www.politico.com/magazine/story/2016/04/gop-2016-paul-ryan-cleveland-213803
so much for democracy.
which is mob rule.
but now we have back-room sleeze
How's that gonna work out, GOP?
“Because the system is corrupt.”
“Because the system is corrupt.”
http://www.wnd.com/2016/04/will-trump-be-swindled-in-cleveland-too/
Ya think?
http://www.wnd.com/2016/04/will-trump-be-swindled-in-cleveland-too/
Ya think?
Bonita Tindle belligerant violent racist needs jail
She just so freely put her hands all over Cory, put her hands all over me, tried to take my property, tried to intimidate us into doing what she wanted,” King said. “That just wasn’t right.
http://kron4.com/2016/03/31/only-on-kron-man-who-took-viral-video-of-dreadlocks-incident-at-san-francisco-state-university-speaks/
Bonita Tindle belligerant violent racist needs jail.
Then, send to Liberia.
http://kron4.com/2016/03/31/only-on-kron-man-who-took-viral-video-of-dreadlocks-incident-at-san-francisco-state-university-speaks/
Bonita Tindle belligerant violent racist needs jail.
Then, send to Liberia.
csmonitor bias
Party insiders are terrified of Trump, an unguided missile of a candidate who has shown no real loyalty to the Republican Party and alienated vast swaths of the general electorate, making success in November difficult to achieve if not impossible.
http://www.csmonitor.com/USA/Politics/2016/0411/Donald-Trump-decries-crooked-delegate-system.-Does-he-have-a-point
Political parties are private organizations, and not governed by the Constitution (which doesn’t even mention parties) or the Federal Election Commission. It’s up to the candidates, and their lawyers, to defend their own interests.
Sure, go ahead with that, RNC.
Bonita Tindle creates more Trump voters than you will ever understand.
http://www.csmonitor.com/USA/Politics/2016/0411/Donald-Trump-decries-crooked-delegate-system.-Does-he-have-a-point
Political parties are private organizations, and not governed by the Constitution (which doesn’t even mention parties) or the Federal Election Commission. It’s up to the candidates, and their lawyers, to defend their own interests.
Sure, go ahead with that, RNC.
Bonita Tindle creates more Trump voters than you will ever understand.
Bonita Tindle is a violent racist
Bonita Tindle is a violent racist.
Do not hire her.
In late March 2016, a YouTube video of her went viral on social media. In the video she confronts another student Cory Soulr Goldstein on San Francisco State University campus for wearing dreadlocks.
https://www.everipedia.com/bonita-tindle/
She thinks she's a photographer
https://www.flickr.com/photos/colorparadigm/
mostly a narcissist it seems.
https://www.tumblr.com/search/bonita%20tindle%20photography
The crime
Do not hire her.
In late March 2016, a YouTube video of her went viral on social media. In the video she confronts another student Cory Soulr Goldstein on San Francisco State University campus for wearing dreadlocks.
https://www.everipedia.com/bonita-tindle/
She thinks she's a photographer
https://www.flickr.com/photos/colorparadigm/
mostly a narcissist it seems.
https://www.tumblr.com/search/bonita%20tindle%20photography
The crime
1
02 April 2016
LOL kill gay son bad; kill transsexual, no conviction
LOL, homosexuals do not deceive; a homosexual will refuse a hetero advance, no harm done.
A transsexual will deceive, and end up getting killed for their deceipt. Pretty simple. The deviant community doesn't seem to "get it".
Bad that a father killed son, son was gay; if son was transsexual and seduced a 3rd party hetero, I would not convict the latter.
Dig?
|
Brinkman bbqs suck
A few years ago, I spent $150 on a Brinkman propane grill.
It had a lot of stainless. Looked nice.
Well, 3 years later, the stainless is fine, but the bottom structure is rust paper. What crap. How can you make something that is durable except for one (critical) part?
What crap.
So today after an attempt to save the old one I bought a new small gas grill. Unfortunately it uses LP cylinders, not propane. I think there are adapters.
I could have bought a $80 stainless version of my $30 grille, but I know how the "stainless" may not cover all parts, in which case, BS. Totally disgusted by the industry, I am.
Note that I spent ~$60 repairing the Brinkman before it was toast.
New burner tubes, heat distributers. At super-expensive prices.
Total BS. Don't buy Brinkman.
Next BBQ, I make my own from a regulator and pipes and a drill.
BS.
PPS: I once had an excellent heavy ceramic charcoal-fired BBQ. Souped that mother up with a computer fan. It cracked when we moved though. Sad. But I've worked with seriously pro ovens.
Also, electric, of course.
It had a lot of stainless. Looked nice.
Well, 3 years later, the stainless is fine, but the bottom structure is rust paper. What crap. How can you make something that is durable except for one (critical) part?
What crap.
So today after an attempt to save the old one I bought a new small gas grill. Unfortunately it uses LP cylinders, not propane. I think there are adapters.
I could have bought a $80 stainless version of my $30 grille, but I know how the "stainless" may not cover all parts, in which case, BS. Totally disgusted by the industry, I am.
Note that I spent ~$60 repairing the Brinkman before it was toast.
New burner tubes, heat distributers. At super-expensive prices.
Total BS. Don't buy Brinkman.
Next BBQ, I make my own from a regulator and pipes and a drill.
BS.
PPS: I once had an excellent heavy ceramic charcoal-fired BBQ. Souped that mother up with a computer fan. It cracked when we moved though. Sad. But I've worked with seriously pro ovens.
Also, electric, of course.
27 March 2016
The horror, the horror
http://pix11.com/2016/03/22/mta-toy-subway-car-shows-image-of-man-in-confederate-flag-shirt/
MTA toy subway car appears to show image of man in Confederate flag shirt
25 March 2016
Lindsey Graham goes down
Graham told host Trevor Noah, grinning and seemingly aware of his own bullshit.
"If Trump wins, your days are numbered, pal," he said. "Young, black, liberal guy from Africa is not going to work with him."
http://www.motherjones.com/mixed-media/2016/03/lindsey-graham-daily-show-ted-cruz-donald-trump
"If Trump wins, your days are numbered, pal," he said. "Young, black, liberal guy from Africa is not going to work with him."
http://www.motherjones.com/mixed-media/2016/03/lindsey-graham-daily-show-ted-cruz-donald-trump
Lindsey Graham fellates McCain, redux
http://www.motherjones.com/mixed-media/2016/03/lindsey-graham-daily-show-ted-cruz-donald-trump
Lindsey Graham Just Went Off on Donald Trump and the GOP: "My Party Is Completely Screwed Up"
No, Lindsey, you screwed up when you slept with John McCain.
rat copulation
Wow,
we now have wife wrestling AND rodent copulation
thank you ted & heidi cruz for that wonderful image.
Rodent copulation, from Ted Cruz. Nice.
we now have wife wrestling AND rodent copulation
thank you ted & heidi cruz for that wonderful image.
Rodent copulation, from Ted Cruz. Nice.
An Impossible Choice Between Donald Trump and Hillary Clinton
An Impossible Choice Between Donald Trump and Hillary Clinton
http://www.theatlantic.com/politics/archive/2016/03/carlos-curbelo-trump-republicans/475515/
ZOMG if you think this is an impossible choice you don't understand freedom.
Mother Jones is an ISIS material supporter
http://www.motherjones.com/politics/2016/03/donald-trump-isis-recruitment-video
"Trump is playing directly into what ISIS wants: Broad anti-Muslim rhetoric that pushes Muslims to the fringes of society"
Actually Trump wants to disengage from the ME, sort of like Paul, or any decent libertarian. Let them deal with themselves; we don't even need their fuels any more.
Trump sez: integrate or leave. For mexicans, ME, everyone. Not a bad idea.
"Trump is playing directly into what ISIS wants: Broad anti-Muslim rhetoric that pushes Muslims to the fringes of society"
Actually Trump wants to disengage from the ME, sort of like Paul, or any decent libertarian. Let them deal with themselves; we don't even need their fuels any more.
Trump sez: integrate or leave. For mexicans, ME, everyone. Not a bad idea.
NPR vs. AM talk radio
I used to listen to NPR exclusively, except for 91.5 classical.
But I got really sick of their ethnic sexual-deviant encouragement, so now I have to listen to AM talk radio stations to purge myself of this. I listen to both genres with ironic, humor quotes around them, but NPR just slimes after a while.
Its is also amusing to hear Glenn Beck flip out at DJT, like the rest of the establishment.
But I got really sick of their ethnic sexual-deviant encouragement, so now I have to listen to AM talk radio stations to purge myself of this. I listen to both genres with ironic, humor quotes around them, but NPR just slimes after a while.
Its is also amusing to hear Glenn Beck flip out at DJT, like the rest of the establishment.
Trump / Palin 2016
Palin is rural, and far from NYC.
Trump is urban, NYC.
Palin like Biden would be a hilarious sidekick bozo, and ensure that the primary will not be assassinated.
Trump/Palin 2016
Its beautiful. Its huge. Its your future.
Trump is urban, NYC.
Palin like Biden would be a hilarious sidekick bozo, and ensure that the primary will not be assassinated.
Trump/Palin 2016
Its beautiful. Its huge. Its your future.
boycott American Airlines, Wells Fargo, Lowe’s and the National Basketball Association freakazoids
https://www.washingtonpost.com/news/post-nation/wp/2016/03/25/wrong-beyond-repair-the-worst-in-us-n-c-papers-blast-transgender-bathroom-law/?tid=pm_national_pop_b
boycott the American Airlines, Wells Fargo, Lowe’s and the Negro Basketball Association
they support mentally-ill freakazoids who will let disturbed men into your daughter's bathrooms.
Nice.
boycott the American Airlines, Wells Fargo, Lowe’s and the Negro Basketball Association
they support mentally-ill freakazoids who will let disturbed men into your daughter's bathrooms.
Nice.
22 March 2016
Mizzou, Click, Can I get some muscle as an example of Leftist power hierarchies
So when Melissa Click, a white female Mizzou prof who thought she was protecting a negro enclave, called for "muscle" against an Asian journalist, it was an expression of the Left's power structure. Asians, as high performers, can be suppressed by white females defending negros.
Fascinating.
18 March 2016
Porter Ranch California, Aliso Methane Leak, Statistics, Placebo
So now that the Porter Ranch gas leak is capped, the gas company has to deal with people who think their nosebleeds, headaches, nausea are from residuals.
They'd never know if the gas wasn't odorized with mercaptans.
There is a background rate of nosebleeds, headaches, nausea.
There are > 1000 wealthy families affected so do the math.
Plus, paranoia / ignorance.
....
Also, LOL,
LA tells customers to conserve water, but has pipe bursts that nullify that, creating temporary rivers in streets.
Gas company tries to be "carbon friendly" then has a huge gas spill.
Worry about coal sulphur. Because. Pinatabo.
I do take lead and mercury and other heavy metal poisonings seriously to the affected people.
They'd never know if the gas wasn't odorized with mercaptans.
There is a background rate of nosebleeds, headaches, nausea.
There are > 1000 wealthy families affected so do the math.
Plus, paranoia / ignorance.
....
Also, LOL,
LA tells customers to conserve water, but has pipe bursts that nullify that, creating temporary rivers in streets.
Gas company tries to be "carbon friendly" then has a huge gas spill.
Worry about coal sulphur. Because. Pinatabo.
I do take lead and mercury and other heavy metal poisonings seriously to the affected people.
03 March 2016
count to 10 donald
jeebus crispus.
initiate self-destruct sequence
bring in some muscle
and microagressions
sterilize the planet, scotty
initiate self-destruct sequence
bring in some muscle
and microagressions
sterilize the planet, scotty
I'm allergic to juniper
I made juniper infused vodka. And I got the hives again.
Wow.
Self-experimentation. And surprise.
Wow.
Wow.
Self-experimentation. And surprise.
Wow.
hope. Change. Trump.
don't hire a house negro who will toe the zionist and milindustrial line.
hire donald.
hire donald.
02 March 2016
Africans, negroes, mulattoes, niggers
just to be clear. I work with a few africans. Very competent. I work with some american mulattoes. Also, very competent.
this is distinct from american niggers. do you understand?
have you read _The Bell Curve_, ok, its a thousand pages, and only the last chapter is about race. But, have you?
George Zimmerman is a hero. Trayvon et seq. are violent, impulsive thugs. Do you understand?
Do you?
this is distinct from american niggers. do you understand?
have you read _The Bell Curve_, ok, its a thousand pages, and only the last chapter is about race. But, have you?
George Zimmerman is a hero. Trayvon et seq. are violent, impulsive thugs. Do you understand?
Do you?
20 February 2016
trumpiverse vs. negro entitlement
In the trumpiverse, the negroes will not block roads, will not threaten reporters, will not require safe ghetto spaces,
and will generally behave like everyone else.
Or not. And be culled. Their choice.
LOL.
Trumpiverse. Dig it, mofo. Suck it.
and will generally behave like everyone else.
Or not. And be culled. Their choice.
LOL.
Trumpiverse. Dig it, mofo. Suck it.
TRUMP
You will wake up in the next year, and realize, DJT is president, Vladimir is not a problem, and isis is toast.
We will eventually get out of middle east, etc. We will have jobs, charge large tariffs for foreign work, have immigration controls for real,. Maybe I'm just a dreamer. No Rand Paul, no Ron Paul. So, deal with it.
We will eventually get out of middle east, etc. We will have jobs, charge large tariffs for foreign work, have immigration controls for real,. Maybe I'm just a dreamer. No Rand Paul, no Ron Paul. So, deal with it.
15 February 2016
Kanye West vs. Kardassians: Cannibalism Island
New reality TV show. Put West and some Kardassians on an island. With no food. See who reverts to cannibalism first.
Total win no matter what.
Do not rescue any of them. For the good of humanity.
Total win no matter what.
Do not rescue any of them. For the good of humanity.
back to this blog
Odd. Now I can write to this blog again.
Very windy, warm out. Love it, February.
My piss fluoresces because I drink G&T
My korean roomba is awesome.
Although the weakest force, we surrender to gravity when we sleep.
I have some systematic ? problem that is small itchy spots appearing randomly on my body. Not sure if virus, parasite, or what. Should be gone in a month or I'll invoke western med I suppose. Likely not.
I found my second oil pen. then lost it; the first is charging upstairs. So lame. Will get control.
Received my $10 green laser, awesome. Uses same 18650 battery as UV laser. China is awesome.
Very windy, warm out. Love it, February.
My piss fluoresces because I drink G&T
My korean roomba is awesome.
Although the weakest force, we surrender to gravity when we sleep.
I have some systematic ? problem that is small itchy spots appearing randomly on my body. Not sure if virus, parasite, or what. Should be gone in a month or I'll invoke western med I suppose. Likely not.
I found my second oil pen. then lost it; the first is charging upstairs. So lame. Will get control.
Received my $10 green laser, awesome. Uses same 18650 battery as UV laser. China is awesome.
14 July 2015
visualize secession
Stars and bars may help you.
Negroes should wear trigger warning signs.
You do not have to associate with those you chose not to. For any reason, including creed and those silly religions that have supernatural superheroes. Or creators made out of pasta.
Negroes should wear trigger warning signs.
You do not have to associate with those you chose not to. For any reason, including creed and those silly religions that have supernatural superheroes. Or creators made out of pasta.
Kaitlyn and Dolezal to marry in AME
In a final 21st century exercise of the decay of civilization.
Meanwhile, my beagle-terrier self identifies as a husky, and expects to be treated as such.
Meanwhile, my beagle-terrier self identifies as a husky, and expects to be treated as such.
Corp
“Our diverse portfolio and scale are enabling this performance, and we’ve continued to invest in building a robust enterprise pipeline that will drive our growth over the long term. Our passion to deliver transformational new medicines and products reflects the ongoing commitment of our dedicated employees to improve whatever."
23 January 2015
my life in the bush of ghosts
Woman with headscarf. Talks like a total socal girl.
Recently she's been sitting on large ball in front of her computer.
This is pretty hilarious.
Recently she's been sitting on large ball in front of her computer.
This is pretty hilarious.
shotguns, bullies, doane-stuart school, dawn cruikshank, noel scudds
Shotguns are preferred against bullies.
In my youth: Dawn Cruikshank, a woman my age in our religious Sacred Heart school, Doane-Stuart in Albany, NY. One day, not at school any more.
Never discussed at school: she got tired of her step father's blowjobs so she shot him. She died of cancer in jail after 2 years; I have to think it was self-inflicted cancer.
Noel Scudds, a white lowlife in Pittstown, NY. Got sick of his older brother, also somewhat of a bully, and shotgunned him. I was so happy to hear this.
Go figure. Life is weird.
In my youth: Dawn Cruikshank, a woman my age in our religious Sacred Heart school, Doane-Stuart in Albany, NY. One day, not at school any more.
Never discussed at school: she got tired of her step father's blowjobs so she shot him. She died of cancer in jail after 2 years; I have to think it was self-inflicted cancer.
Noel Scudds, a white lowlife in Pittstown, NY. Got sick of his older brother, also somewhat of a bully, and shotgunned him. I was so happy to hear this.
Go figure. Life is weird.
17 January 2015
charlie bbc
je suis charlie
don't f with the first amendment. you can have your caliphate, us should withdraw, crusades over. I agree; read fatwa. territory.
do not
ps bbc is total pussy pander
16 January 2015
luxo jr.
I am learning ecmascript so I can introduce the kid to coding.
Benefits: environment there if you have chrome (incl. html5 graphics & input, not yet explored). immediate gratification from graphics in a few lines. (not yet tested) easy input. PONG game as base-project should be easy, once you get: drawing, state update, timer-animation, and input.
PONG
Then he is on his own.
Benefits: environment there if you have chrome (incl. html5 graphics & input, not yet explored). immediate gratification from graphics in a few lines. (not yet tested) easy input. PONG game as base-project should be easy, once you get: drawing, state update, timer-animation, and input.
PONG
Then he is on his own.
Je suis Charlie
It would be good if the west left the ME alone. The west could buy stuff, if sold at reasonable prices. Otherwise, let them solve their civil-war problems themselves. Then they won't bother you.
Read the FATWA genius.
So many hollow companies, nothing but funders for outsourced development, sales, distribution, complaints, etc. [Latter required for FDA registered MDD]
Nesting:
Device Change Plan
... Software Change Plan
......SW requirements --> user's guide, --> SW test
.........SW design
............SW implem
...............SW test
iterate
For each plan, a Report
Agile is inappropriate when you need multifunctional teams to evaluate software change requests.
Read the FATWA genius.
So many hollow companies, nothing but funders for outsourced development, sales, distribution, complaints, etc. [Latter required for FDA registered MDD]
Nesting:
Device Change Plan
... Software Change Plan
......SW requirements --> user's guide, --> SW test
.........SW design
............SW implem
...............SW test
iterate
For each plan, a Report
Agile is inappropriate when you need multifunctional teams to evaluate software change requests.
24 December 2014
Sleep Troubles at Sony
Sleeping pills:
Clonazepam
Rx#C 1051297
Dr. Steven Witlin
Lunesta
Rx#C1046974
(prescription filled 9/30/13, 3 refills before 3/29/14)
Celebrex
(In Michael Lynton's Contacts)
Clonazepam
Rx#C 1051297
Dr. Steven Witlin
Lunesta
Rx#C1046974
(prescription filled 9/30/13, 3 refills before 3/29/14)
Celebrex
(In Michael Lynton's Contacts)
03 December 2014
Fascist America Garner cigs
Hi.
Garner's death. That is f'd up.
Martin, shoot that nig.
Brown, double that.
Garner, WTF? Yeah, great, I learn a chokehold is awesome. And some dipshit nypd is dipshit.
I am obviously not really racist.... Garner was killed unjustly. For a GJ to fail to indict in that case is awful. (For real jury for GZ acquit, and Brown stone charge, perfect).
Selling loose cigs is not worth a chokehold, asshole.
Garner's death. That is f'd up.
Martin, shoot that nig.
Brown, double that.
Garner, WTF? Yeah, great, I learn a chokehold is awesome. And some dipshit nypd is dipshit.
I am obviously not really racist.... Garner was killed unjustly. For a GJ to fail to indict in that case is awful. (For real jury for GZ acquit, and Brown stone charge, perfect).
Selling loose cigs is not worth a chokehold, asshole.
02 November 2014
Spaceship death
Branson is pretty Howard Roarke.
NTSB spokesman is excellent. Christoper A Hart.
"Do they have black boxes" it was a frickin' test flight, Mr. Reporter.
Hybrid rockets are fun, but
1. not hypergolic
2. don't sub your fuel without hundreds of tests... nylon vs. rubber
100 km is a high bar. Even 50 mi if you're now only getting 25 mi.
One could design a better ignition system, even if hypergolic chem is a no-go.
Not clear why a motor explosion should have killed someone... you can design against this... one pilot survived... at least the dead was probably killed really quickly...
NTSB spokesman is excellent. Christoper A Hart.
"Do they have black boxes" it was a frickin' test flight, Mr. Reporter.
Hybrid rockets are fun, but
1. not hypergolic
2. don't sub your fuel without hundreds of tests... nylon vs. rubber
100 km is a high bar. Even 50 mi if you're now only getting 25 mi.
One could design a better ignition system, even if hypergolic chem is a no-go.
Not clear why a motor explosion should have killed someone... you can design against this... one pilot survived... at least the dead was probably killed really quickly...
26 October 2014
dead canadians
Hey Canada, do you have any tall buildings near airports?
Oh wait, you have Niagara, which powers NYC. Roger.
Oh wait, you have Niagara, which powers NYC. Roger.
NYC is toast, like liberia, ebolafrica
26 Oct 2014.
Doctor with MSF brings back ebola. Takes NYC subway.
Two weeks hence: random ebola cases show up in NYC. Untraceable.
Bye bye NYC. How many bridges do we have to blow? How many airfields to crater?
Quarantine with extreme prejudice.
Meanwhile, DC plays the fiddle...
Doctor with MSF brings back ebola. Takes NYC subway.
Two weeks hence: random ebola cases show up in NYC. Untraceable.
Bye bye NYC. How many bridges do we have to blow? How many airfields to crater?
Quarantine with extreme prejudice.
Meanwhile, DC plays the fiddle...
24 October 2014
annie lennox = marilyn manson
I just realized that annie lennox is the prototype for marilyn manson. they are both most excellent singers and thinkers.
mali is toast
LOL, mali just got nukes by a niglet...
1 million in 1 year; everyone in 2 years.
Under 20 KB, 7 genes, game over.
Malthus.
Famine, plague, war, or birth control.
Can I have freedom fries with my bushmeat sandwich?
1 million in 1 year; everyone in 2 years.
Under 20 KB, 7 genes, game over.
Malthus.
Famine, plague, war, or birth control.
Can I have freedom fries with my bushmeat sandwich?
23 October 2014
dead canadians
So the Canadians think they can lapdog the US and colonize the opposite side of the planet, without feedback?
LOL, 911 Canada.
LOL, collaborators with US militarizism are legit targets. Even Canadian civilians, but the soldiers are more visible.
LOL fail.
LOL rome falling in a day.
LOL glass empires ought not fly drones
LOL Obama peace prize
LOL Ebola
LOL, 911 Canada.
LOL, collaborators with US militarizism are legit targets. Even Canadian civilians, but the soldiers are more visible.
LOL fail.
LOL rome falling in a day.
LOL glass empires ought not fly drones
LOL Obama peace prize
LOL Ebola
gamergate
Please use "terror" more times than this moron, I defy you.
http://www.salon.com/2014/10/23/gamergate_is_really_about_terrorism_why_bill_maher_should_be_vilifying_the_gaming_community_too/
Everything is terrorism. Jury duty, selective service, DEA. And this loon goes on about some teenage "gamers".
http://www.salon.com/2014/10/23/gamergate_is_really_about_terrorism_why_bill_maher_should_be_vilifying_the_gaming_community_too/
Everything is terrorism. Jury duty, selective service, DEA. And this loon goes on about some teenage "gamers".
22 October 2014
Navy Seals contragate
http://www.washingtonpost.com/world/national-security/in-a-federal-trial-examining-a-classified-military-deal-dont-mention-the-navy-seals/2014/10/22/425ba28e-5a14-11e4-b812-38518ae74c67_story.html
Navy Seals caught buying illicit weapons for black ops.
Silencers for AKs.
Americans will forget this if they ever knew it.
To their peril, of course.
Navy Seals caught buying illicit weapons for black ops.
Silencers for AKs.
Americans will forget this if they ever knew it.
To their peril, of course.
13 October 2014
All your snappy chat pubes are ours
http://www.csmonitor.com/Innovation/2014/1013/Snapchat-leak-Why-you-shouldn-t-look-at-these-images-video
LOL, more child pornographer minors (minors producing self-childporn) get caught. They published auto-child-porn, (self-pedophiliaphotography according to DSM-VII) thinking there was a diffference between "private" "cloud" and "publish forever"
LOLOLOLOLOLOLOL
All your pubes are ours!
No, seriously, do you see what idiots most of the species are?
You invent a species capable of anything, what do they do, they invent facebook and post images their genitals, which offends the previous generation (who has no idea how anything works, being, in general, palefaced legacy types who play with money and wordsmithing and never actually generate value or anythying that can be measured as value; human placeholders if you will, corporate amerika. See 12 monkeys etc)
LOL, more child pornographer minors (minors producing self-childporn) get caught. They published auto-child-porn, (self-pedophiliaphotography according to DSM-VII) thinking there was a diffference between "private" "cloud" and "publish forever"
LOLOLOLOLOLOLOL
All your pubes are ours!
No, seriously, do you see what idiots most of the species are?
You invent a species capable of anything, what do they do, they invent facebook and post images their genitals, which offends the previous generation (who has no idea how anything works, being, in general, palefaced legacy types who play with money and wordsmithing and never actually generate value or anythying that can be measured as value; human placeholders if you will, corporate amerika. See 12 monkeys etc)
09 October 2014
end times
And it’s then that the ayatollahs will show their true face and unleash their aggressive fanaticism on the entire world.”
As my cia, fbi, dia, nsa, etc monitors know, I am a rabid atheist and will resist religous oppression of any and all forms. However, I'm not so happy about .il having a few dozen trit boosted pits, if you know what I mean.
Not that my opinion matters.
Frankly, let them glass themselves, NA petrol is more valuable with zero risk (Damn Canadians!). Yes, as a lib, I'm predictably isolationalist, as in, let the savages f themselves. Even the europeans. Despite my relatives becoming soap, lampshades, etc.
So, laddies.
The solution to Global Warming (tm), overpop (same), idiocracy, african orphans is ebola.
The cure for Boko is ebola.
The cure for ebola is napalm.
Any questions?
My opinion is insignificant. Truth, consistent with physical (and bio / info) laws is not.
Exponential growth is hilarious; its always a sigmoid.
Sucks to be human.
Thanks, Frank Whittle for that engine o' yurz. Vector.
As my cia, fbi, dia, nsa, etc monitors know, I am a rabid atheist and will resist religous oppression of any and all forms. However, I'm not so happy about .il having a few dozen trit boosted pits, if you know what I mean.
Not that my opinion matters.
Frankly, let them glass themselves, NA petrol is more valuable with zero risk (Damn Canadians!). Yes, as a lib, I'm predictably isolationalist, as in, let the savages f themselves. Even the europeans. Despite my relatives becoming soap, lampshades, etc.
So, laddies.
The solution to Global Warming (tm), overpop (same), idiocracy, african orphans is ebola.
The cure for Boko is ebola.
The cure for ebola is napalm.
Any questions?
My opinion is insignificant. Truth, consistent with physical (and bio / info) laws is not.
Exponential growth is hilarious; its always a sigmoid.
Sucks to be human.
Thanks, Frank Whittle for that engine o' yurz. Vector.
14 September 2014
planes need airfields
Crater airfields, mine harbors, nothing leaves.
Snipers sans frontieres. Quarantine with extreme prejudice.
Civilization is a choice. Make it.
Famine, plague, war, or birth control. You had a choice.
Overpopulation is not a joke, and nature has feedback. Talk to Malthus.
Overpopulation is not a joke, and nature has feedback. Talk to Malthus.
Take the population to back before the West started feeding africans (and their wars, etc)
Can I have a side of fries with my fruitbat?
Plane full of nigerians on Hajj
http://www.washingtonpost.com/posttv/world/stringent-ebola-checks-for-3-million-haj-pilgrims/2014/09/13/76a7a0f6-3b7e-11e4-a023-1d61f7f31a05_video.html
What could possibly go wrong?
10 September 2014
911 Redux, ISIS, Saudi pawns
http://www.nytimes.com/2014/09/11/world/middleeast/saudi-arabia-isis.html?_r=0
US getting a Saudi base again. So we can pwn them if necessary, and expand empire to region.
Except US in Saudi was what 911 was about, and now Obama is following Osama's plan for sucking in the Amerikans.
Oh, and most 911 folks were Saudis. LOL. "Best friends"
And israel's whore.
We should let them all fight their civil wars and nuke themselves. We are not zion, we are not ME. We should protect our borders and evict illegals. Jail Feinstein, Lieberman as foreign agents. Put King in an asylum.
What part of "not our problem" don't they understand?
Oh right, the mil industrial complex relies on this.
Oh right, the chinese own the US, and will take taiwan.
Oh right, empires don't fall overnight, but things do happen faster now.
And, oh right. Because ebola. Because africa.
Because.
Enjoy.
But instead, illegals come in, Obama invades the other side of the planet (whilst living in a glass empire, he flies drones).
Will not be surprised by 10 kilotons; only hope it will be over DC.
US getting a Saudi base again. So we can pwn them if necessary, and expand empire to region.
Except US in Saudi was what 911 was about, and now Obama is following Osama's plan for sucking in the Amerikans.
Oh, and most 911 folks were Saudis. LOL. "Best friends"
And israel's whore.
We should let them all fight their civil wars and nuke themselves. We are not zion, we are not ME. We should protect our borders and evict illegals. Jail Feinstein, Lieberman as foreign agents. Put King in an asylum.
What part of "not our problem" don't they understand?
Oh right, the mil industrial complex relies on this.
Oh right, the chinese own the US, and will take taiwan.
Oh right, empires don't fall overnight, but things do happen faster now.
And, oh right. Because ebola. Because africa.
Because.
Enjoy.
But instead, illegals come in, Obama invades the other side of the planet (whilst living in a glass empire, he flies drones).
Will not be surprised by 10 kilotons; only hope it will be over DC.
09 September 2014
DO IT SCOTLAND
Scotland, this is your chance. You can remain part of the festering cesspool, and remain a target because of your intervention; or you can be the new Switzerland, a land of prosperity and neutrality.
Your choice. Decide.
Your choice. Decide.
John McCain blasts John McCain for being less of a douche than possible
[Washington, DC] Senator John McCain blasted himself for being less of hawkish douche than normal. The senator, who rode to fame on his daddy's coattails followed by a serious fail over Viet Nam, castigated himself for less rabid speech than usual. Married-rich and admitted war-criminal John Kerry agreed. No other combat veterans were available, except for Ron Paul, who spit when he heard of these antics.
07 September 2014
Serena Williams is a male
http://www.huffingtonpost.com/2014/09/07/serena-williams-us-open-title_n_5781122.html
Williams and her/his sister is a freak, with hormonal problems that make them male. Yet they compete in female sports.
Freaks, niggs, yet unchallenged. Lance Armstrong wasn't such a freak.
Williams and her/his sister is a freak, with hormonal problems that make them male. Yet they compete in female sports.
Freaks, niggs, yet unchallenged. Lance Armstrong wasn't such a freak.
LOL 500 kt of freedom over DC
The shirt a Navy SEAL wore in the raid that killed Osama bin Laden and a special coin given to a CIA officer who played a key role in finding him are being displayed at the Sept. 11 museum,
LOL Detroit cadillac
General Motors Co. (GM:US), the largest U.S. automaker, will introduce a Cadillac model in two years that can be driven on the highway without the driver holding the steering wheel or putting a foot on a pedal.
LAWYER UP!
LAWYER UP!
More jews on nigball
(i.e., hip hop vs. country, white vs. black cheerleaders, etc.) and by stereotyping their perceptions of one another (i.e., that white fans might be afraid of our black fans). By focusing on race, I also sent the unintentional and hurtful message that our white fans are more valuable than our black fans."
Bruce Levenson speaking the truth, which gets him fired.
LOL, niggas.
03 September 2014
McKayla Maroney
A wikipedia description of McKayla Maroney's reaction to unauthorized copying and publishing of images she distributed. Includes a description of the images for the visually impaired.
01 September 2014
Leaked nudes
"It's so weird and hard how people take your privacy away from you."
Its so weird how idiots think that anything online is not published.
----
“The authorities have been contacted and will prosecute anyone who posts the stolen photos of Jennifer Lawrence" -said a PR stooge with zero clue.
and it gets better
“Knowing those photos were deleted long ago" ---You cannot use "deleted" and "internet", "cloud", or "online" in the same sentence. You cannot use the word "privacy" when you use an Apple, Inc. service or gadget.
Its so weird how idiots think that anything online is not published.
----
“The authorities have been contacted and will prosecute anyone who posts the stolen photos of Jennifer Lawrence" -said a PR stooge with zero clue.
and it gets better
“Knowing those photos were deleted long ago" ---You cannot use "deleted" and "internet", "cloud", or "online" in the same sentence. You cannot use the word "privacy" when you use an Apple, Inc. service or gadget.
30 August 2014
Ebola update
Ebola spread in one country because of a witchdoctor's funeral.
Love it! The irony! Excellent juju magic!
CDC says 20K deaths expected. They are low by a few orders of magnitude.
Liberia opening their infected slum. Liberia is now toast. And surrounding countries too.
Nuclear carpet bombing. Or napalm.
And africans lie about their contacts, spreading it. Gotta love this!
Some vaccine works on monkeys. Lol, africans and monkeys, how racist.
CDC not reporting deaths since underreported and too many.
Exponential growth! And an RNA virus mutates quickly, too.
Crater airfields, mine harbors. Snipers sans frontieres. Quarantine with extreme prejudice. Civilization is choice.
Kill it with fire.
1918 was for pussies.
And yet, the US still lets africans in. And has a porous border.
With extreme prejudice. Apocalpyse now, if you don't.
Love it! The irony! Excellent juju magic!
CDC says 20K deaths expected. They are low by a few orders of magnitude.
Liberia opening their infected slum. Liberia is now toast. And surrounding countries too.
Nuclear carpet bombing. Or napalm.
And africans lie about their contacts, spreading it. Gotta love this!
Some vaccine works on monkeys. Lol, africans and monkeys, how racist.
CDC not reporting deaths since underreported and too many.
Exponential growth! And an RNA virus mutates quickly, too.
Crater airfields, mine harbors. Snipers sans frontieres. Quarantine with extreme prejudice. Civilization is choice.
Kill it with fire.
1918 was for pussies.
And yet, the US still lets africans in. And has a porous border.
With extreme prejudice. Apocalpyse now, if you don't.
26 August 2014
Most awesome jihadi name ever: Douglas McArthur McCain
Douglas McArthur McCain
We salute your name. As does the Sen John (toilet) McCain and the admiral father whose coat-tails the loser-pilot rode.
Douglas McArthur McCain. Damn. Awesome.
We salute your name. As does the Sen John (toilet) McCain and the admiral father whose coat-tails the loser-pilot rode.
Douglas McArthur McCain. Damn. Awesome.
18 August 2014
trayvon brown
A young (arrogant) male (aggressive) black (impulsive) who is intoxicated beyond his ability to handle it attacks someone with a gun.
Evolution never sleeps.
And then the moneys riot. And mouth words like respeckt.
Seriously, g and a standard deviation and Murray etc.
Its basically a media circus at this point.
And pointless. Ebola in Ferguson, soon.
Evolution never sleeps.
And then the moneys riot. And mouth words like respeckt.
Seriously, g and a standard deviation and Murray etc.
Its basically a media circus at this point.
And pointless. Ebola in Ferguson, soon.
the first woodpecker
2xAES256 doesn't equal AES512. Look up meet-in-the-middle attacks.
If you depend on a single algorithm (e.g., AES) instead of a chain of independent (in several senses) algorithms (eg AES followed by a few other contenders) you are a pathetic optimist.
Computation is free. (Meh, batteries)
Because Snowden.
As if you didn't know. Gilmore.
Other links are weaker: key distribution, your children, your OS, videobugs. But really, depending on one approved algorithm? And hbleed? And gotoFucked?
TCMay may forgive your souls. Unlikely though, he is a harsh master.
I'll see your DNS worm and raise you a BGP attack. Or maybe ve sent de death packet und you gives us der Taivan.
Please tell me you didn't just build the latest version of your civilization on a prototype.
16 August 2014
Sequence
CGGACACACAAAAAGAAAGAAGAATTTTTAGGATCTTTTGTGTGCGAATAACTATGAGGAAGATTAATAA
TTTTCCTCTCATTGAAATTTATATCGGAATTTAAATTGAAATTGTTACTGTAATCACACCTGGTTTGTTT
CAGAGCCACATCACAAAGATAGAGAACAACCTAGGTCTCCGAAGGGAGCAAGGGCATCAGTGTGCTCAGT
TGAAAATCCCTTGTCAACACCTAGGTCTTATCACATCACAAGTTCCACCTCAGACTCTGCAGGGTGATCC
AACAACCTTAATAGAAACATTATTGTTAAAGGACAGCATTAGTTCACAGTCAAACAAGCAAGATTGAGAA
TTAACCTTGGTTTTGAACTTGAACACTTAGGGGATTGAAGATTCAACAACCCTAAAGCTTGGGGTAAAAC
ATTGGAAATAGTTAAAAGACAAATTGCTCGGAATCACAAAATTCCGAGTATGGATTCTCGTCCTCAGAAA
ATCTGGATGGCGCCGAGTCTCACTGAATCTGACATGGATTACCACAAGATCTTGACAGCAGGTCTGTCCG
TTCAACAGGGGATTGTTCGGCAAAGAGTCATCCCAGTGTATCAAGTAAACAATCTTGAAGAAATTTGCCA
ACTTATCATACAGGCCTTTGAAGCAGGTGTTGATTTTCAAGAGAGTGCGGACAGTTTCCTTCTCATGCTT
TGTCTTCATCATGCGTACCAGGGAGATTACAAACTTTTCTTGGAAAGTGGCGCAGTCAAGTATTTGGAAG
GGCACGGGTTCCGTTTTGAAGTCAAGAAGCGTGATGGAGTGAAGCGCCTTGAGGAATTGCTGCCAGCAGT
ATCTAGTGGAAAAAACATTAAGAGAACACTTGCTGCCATGCCGGAAGAGGAGACAACTGAAGCTAATGCC
GGTCAGTTTCTCTCCTTTGCAAGTCTATTCCTTCCGAAATTGGTAGTAGGAGAAAAGGCTTGCCTTGAGA
AGGTTCAAAGGCAAATTCAAGTACATGCAGAGCAAGGACTGATACAATATCCAACAGCTTGGCAATCAGT
AGGACACATGATGGTGATTTTCCGTTTGATGCGAACAAATTTTCTGATCAAATTTCTCCTAATACACCAA
GGGATGCACATGGTTGCCGGGCATGATGCCAACGATGCTGTGATTTCAAATTCAGTGGCTCAAGCTCGTT
TTTCAGGCTTATTGATTGTCAAAACAGTACTTGATCATATCCTACAAAAGACAGAACGAGGAGTTCGTCT
CCATCCTCTTGCAAGGACCGCCAAGGTAAAAAATGAGGTGAACTCCTTTAAGGCTGCACTCAGCTCCCTG
GCCAAGCATGGAGAGTATGCTCCTTTCGCCCGACTTTTGAACCTTTCTGGAGTAAATAATCTTGAGCATG
GTCTTTTCCCTCAACTATCGGCAATTGCACTCGGAGTCGCCACAGCACACGGGAGTACCCTCGCAGGAGT
AAATGTTGGAGAACAGTATCAACAACTCAGAGAGGCTGCCACTGAGGCTGAGAAGCAACTCCAACAATAT
GCAGAGTCTCGCGAACTTGACCATCTTGGACTTGATGATCAGGAAAAGAAAATTCTTATGAACTTCCATC
AGAAAAAGAACGAAATCAGCTTCCAGCAAACAAACGCTATGGTAACTCTAAGAAAAGAGCGCCTGGCCAA
GCTGACAGAAGCTATCACTGCTGCGTCACTGCCCAAAACAAGTGGACATTACGATGATGATGACGACATT
CCCTTTCCAGGACCCATCAATGATGACGACAATCCTGGCCATCAAGATGATGATCCGACTGACTCACAGG
ATACGACCATTCCCGATGTGGTGGTTGATCCCGATGATGGAAGCTACGGCGAATACCAGAGTTACTCGGA
AAACGGCATGAATGCACCAGATGACTTGGTCCTATTCGATCTAGACGAGGACGACGAGGACACTAAGCCA
GTGCCTAATAGATCGACCAAGGGTGGACAACAGAAGAACAGTCAAAAGGGCCAGCATATAGAGGGCAGAC
AGACACAATCCAGGCCAATTCAAAATGTCCCAGGCCCTCACAGAACAATCCACCACGCCAGTGCGCCACT
CACGGACAATGACAGAAGAAATGAACCCTCCGGCTCAACCAGCCCTCGCATGCTGACACCAATTAACGAA
GAGGCAGACCCACTGGACGATGCCGACGACGAGACGTCTAGCCTTCCGCCCTTGGAGTCAGATGATGAAG
AGCAGGACAGGGACGGAACTTCCAACCGCACACCCACTGTCGCCCCACCGGCTCCCGTATACAGAGATCA
CTCTGAAAAGAAAGAACTCCCGCAAGACGAGCAACAAGATCAGGACCACACTCAAGAGGCCAGGAACCAG
GACAGTGACAACACCCAGTCAGAACACTCTTTTGAGGAGATGTATCGCCACATTCTAAGATCACAGGGGC
CATTTGATGCTGTTTTGTATTATCATATGATGAAGGATGAGCCTGTAGTTTTCAGTACCAGTGATGGCAA
AGAGTACACGTATCCAGACTCCCTTGAAGAGGAATATCCACCATGGCTCACTGAAAAAGAGGCTATGAAT
GAAGAGAATAGATTTGTTACATTGGATGGTCAACAATTTTATTGGCCGGTGATGAATCACAAGAATAAAT
TCATGGCAATCCTGCAACATCATCAGTGAATGAGCATGGAACAATGGGATGATTCAACCGACAAATAGCT
AACATTAAGTAGTCAAGGAACGAAAACAGGAAGAATTTTTGATGTCTAAGGTGTGAATTATTATCACAAT
AAAAGTGATTCTTATTTTTGAATTTAAAGCTAGCTTATTATTACTAGCCGTTTTTCAAAGTTCAATTTGA
GTCTTAATGCAAATAGGCGTTAAGCCACAGTTATAGCCATAATTGTAACTCAATATTCTAACTAGCGATT
TATCTAAATTAAATTACATTATGCTTTTATAACTTACCTACTAGCCTGCCCAACATTTACACGATCGTTT
TATAATTAAGAAAAAACTAATGATGAAGATTAAAACCTTCATCATCCTTACGTCAATTGAATTCTCTAGC
ACTCGAAGCTTATTGTCTTCAATGTAAAAGAAAAGCTGGTCTAACAAGATGACAACTAGAACAAAGGGCA
GGGGCCATACTGCGGCCACGACTCAAAACGACAGAATGCCAGGCCCTGAGCTTTCGGGCTGGATCTCTGA
GCAGCTAATGACCGGAAGAATTCCTGTAAGCGACATCTTCTGTGATATTGAGAACAATCCAGGATTATGC
TACGCATCCCAAATGCAACAAACGAAGCCAAACCCGAAGACGCGCAACAGTCAAACCCAAACGGACCCAA
TTTGCAATCATAGTTTTGAGGAGGTAGTACAAACATTGGCTTCATTGGCTACTGTTGTGCAACAACAAAC
CATCGCATCAGAATCATTAGAACAACGCATTACGAGTCTTGAGAATGGTCTAAAGCCAGTTTATGATATG
GCAAAAACAATCTCCTCATTGAACAGGGTTTGTGCTGAGATGGTTGCAAAATATGATCTTCTGGTGATGA
CAACCGGTCGGGCAACAGCAACCGCTGCGGCAACTGAGGCTTATTGGGCCGAACATGGTCAACCACCACC
TGGACCATCACTTTATGAAGAAAGTGCGATTCGGGGTAAGATTGAATCTAGAGATGAGACCGTCCCTCAA
AGTGTTAGGGAGGCATTCAACAATCTAAACAGTACCACTTCACTAACTGAGGAAAATTTTGGGAAACCTG
ACATTTCGGCAAAGGATTTGAGAAACATTATGTATGATCACTTGCCTGGTTTTGGAACTGCTTTCCACCA
ATTAGTACAAGTGATTTGTAAATTGGGAAAAGATAGCAACTCATTGGACATCATTCATGCTGAGTTCCAG
GCCAGCCTGGCTGAAGGAGACTCTCCTCAATGTGCCCTAATTCAAATTACAAAAAGAGTTCCAATCTTCC
AAGATGCTGCTCCACCTGTCATCCACATCCGCTCTCGAGGTGACATTCCCCGAGCTTGCCAGAAAAGCTT
GCGTCCAGTCCCACCATCGCCCAAGATTGATCGAGGTTGGGTATGTGTTTTTCAGCTTCAAGATGGTAAA
ACACTTGGACTCAAAATTTGAGCCAATCTCCCTTCCCTCCGAAAGAGGCGAATAATAGCAGAGGCTTCAA
CTGCTGAACTATAGGGTACGTTACATTAATGATACACTTGTGAGTATCAGCCCTGGATAATATAAGTCAA
TTAAACGACCAAGATAAAATTGTTCATATCTCGCTAGCAGCTTAAAATATAAATGTAATAGGAGCTATAT
CTCTGACAGTATTATAATCAATTGTTATTAAGTAACCCAAACCAAAAGTGATGAAGATTAAGAAAAACCT
ACCTCGGCTGAGAGAGTGTTTTTTCATTAACCTTCATCTTGTAAACGTTGAGCAAAATTGTTAAAAATAT
GAGGCGGGTTATATTGCCTACTGCTCCTCCTGAATATATGGAGGCCATATACCCTGTCAGGTCAAATTCA
ACAATTGCTAGAGGTGGCAACAGCAATACAGGCTTCCTGACACCGGAGTCAGTCAATGGGGACACTCCAT
CGAATCCACTCAGGCCAATTGCCGATGACACCATCGACCATGCCAGCCACACACCAGGCAGTGTGTCATC
AGCATTCATCCTTGAAGCTATGGTGAATGTCATATCGGGCCCCAAAGTGCTAATGAAGCAAATTCCAATT
TGGCTTCCTCTAGGTGTCGCTGATCAAAAGACCTACAGCTTTGACTCAACTACGGCCGCCATCATGCTTG
CTTCATACACTATCACCCATTTCGGCAAGGCAACCAATCCACTTGTCAGAGTCAATCGGCTGGGTCCTGG
AATCCCGGATCATCCCCTCAGGCTCCTGCGAATTGGAAACCAGGCTTTCCTCCAGGAGTTCGTTCTTCCG
CCAGTCCAACTACCCCAGTATTTCACCTTTGATTTGACAGCACTCAAACTGATCACCCAACCACTGCCTG
CTGCAACATGGACCGATGACACTCCAACAGGATCAAATGGAGCGTTGCGTCCAGGAATTTCATTTCATCC
AAAACTTCGCCCCATTCTTTTACCCAACAAAAGTGGGAAGAAGGGGAACAGTGCCGATCTAACATCTCCG
GAGAAAATCCAAGCAATAATGACTTCACTCCAGGACTTTAAGATCGTTCCAATTGATCCAACCAAAAATA
TCATGGGAATCGAAGTGCCAGAAACTCTGGTCCACAAGCTGACCGGTAAGAAGGTGACTTCTAAAAATGG
ACAACCAATCATCCCTGTTCTTTTGCCAAAGTACATTGGGTTGGACCCGGTGGCTCCAGGAGACCTCACC
ATGGTAATCACACAGGATTGTGACACGTGTCATTCTCCTGCAAGTCTTCCAGCTGTGATTGAGAAGTAAT
TGCAATAATTGACTCAGATCCAGTTTTATAGAATCTTCTCAGGGATAGTGATAACATCTATTTAGTAATC
CGTCCATTAGAGGAGACACTTTTAATTGATCAATATACTAAAGGTGCTTTACACCATTGTCTTTTTTCTC
TCCTAAATGTAGAACTTAACAAAAGACTCATAATATACTTGTTTTTAAAGGATTGATTGATGAAAGATCA
TAACTAATAACATTACAAATAATCCTACTATAATCAATACGGTGATTCAAATGTTAATCTTTCTCATTGC
ACATACTTTTTGCCCTTATCCTCAAATTGCCTGCATGCTTACATCTGAGGATAGCCAGTGTGACTTGGAT
TGGAAATGTGGAGAAAAAATCGGGACCCATTTCTAGGTTGTTCACAATCCAAGTACAGACATTGCCCTTC
TAATTAAGAAAAAATCGGCGATGAAGATTAAGCCGACAGTGAGCGTAATCTTCATCTCTCTTAGATTATT
TGTTTTCCAGAGTAGGGGTCGTCAGGTCCTTTTCAATCGTGTAACCAAAATAAACTCCACTAGAAGGATA
TTGTGGGGCAACAACACAATGGGCGTTACAGGAATATTGCAGTTACCTCGTGATCGATTCAAGAGGACAT
CATTCTTTCTTTGGGTAATTATCCTTTTCCAAAGAACATTTTCCATCCCACTTGGAGTCATCCACAATAG
CACATTACAGGTTAGTGATGTCGACAAACTAGTTTGTCGTGACAAACTGTCATCCACAAATCAATTGAGA
TCAGTTGGACTGAATCTCGAAGGGAATGGAGTGGCAACTGACGTGCCATCTGCAACTAAAAGATGGGGCT
TCAGGTCCGGTGTCCCACCAAAGGTGGTCAATTATGAAGCTGGTGAATGGGCTGAAAACTGCTACAATCT
TGAAATCAAAAAACCTGACGGGAGTGAGTGTCTACCAGCAGCGCCAGACGGGATTCGGGGCTTCCCCCGG
TGCCGGTATGTGCACAAAGTATCAGGAACGGGACCGTGTGCCGGAGACTTTGCCTTCCATAAAGAGGGTG
CTTTCTTCCTGTATGATCGACTTGCTTCCACAGTTATCTACCGAGGAACGACTTTCGCTGAAGGTGTCGT
TGCATTTCTGATACTGCCCCAAGCTAAGAAGGACTTCTTCAGCTCACACCCCTTGAGAGAGCCGGTCAAT
GCAACGGAGGACCCGTCTAGTGGCTACTATTCTACCACAATTAGATATCAGGCTACCGGTTTTGGAACCA
ATGAGACAGAGTACTTGTTCGAGGTTGACAATTTGACCTACGTCCAACTTGAATCAAGATTCACACCACA
GTTTCTGCTCCAGCTGAATGAGACAATATATACAAGTGGGAAAAGGAGCAATACCACGGGAAAACTAATT
TGGAAGGTCAACCCCGAAATTGATACAACAATCGGGGAGTGGGCCTTCTGGGAAACTAAAAAAACCTCAC
TAGAAAAATTCGCAGTGAAGAGTTGTCTTTCACAGTTGTATCAAACGGAGCCAAAAACATCAGTGGTCAG
AGTCCGGCGCGAACTTCTTCCGACCCAGGGACCAACACAACAACTGAAGACCACAAAATCATGGCTTCAG
AAAATTCCTCTGCAATGGTTCAAGTGCACAGTCAAGGAAGGGAAGCTGCAGTGTCGCATCTAACAACCCT
TGCCACAATCTCCACGAGTCCCCAATCCCTCACAACCAAACCAGGTCCGGACAACAGCACCCATAATACA
CCCGTGTATAAACTTGACATCTCTGAGGCAACTCAAGTTGAACAACATCACCGCAGAACAGACAACGACA
GCACAGCCTCCGACACTCCCTCTGCCACGACCGCAGCCGGACCCCCAAAAGCAGAGAACACCAACACGAG
CAAGAGCACTGACTTCCTGGACCCCGCCACCACAACAAGTCCCCAAAACCACAGCGAGACCGCTGGCAAC
AACAACACTCATCACCAAGATACCGGAGAAGAGAGTGCCAGCAGCGGGAAGCTAGGCTTAATTACCAATA
CTATTGCTGGAGTCGCAGGACTGATCACAGGCGGGAGAAGAACTCGAAGAGAAGCAATTGTCAATGCTCA
ACCCAAATGCAACCCTAATTTACATTACTGGACTACTCAGGATGAAGGTGCTGCAATCGGACTGGCCTGG
ATACCATATTTCGGGCCAGCAGCCGAGGGAATTTACATAGAGGGGCTAATGCACAATCAAGATGGTTTAA
TCTGTGGGTTGAGACAGCTGGCCAACGAGACGACTCAAGCTCTTCAACTGTTCCTGAGAGCCACAACTGA
GCTACGCACCTTTTCAATCCTCAACCGTAAGGCAATTGATTTCTTGCTGCAGCGATGGGGCGGCACATGC
CACATTCTGGGACCGGACTGCTGTATCGAACCACATGATTGGACCAAGAACATAACAGACAAAATTGATC
AGATTATTCATGATTTTGTTGATAAAACCCTTCCGGACCAGGGGGACAATGACAATTGGTGGACAGGATG
GAGACAATGGATACCGGCAGGTATTGGAGTTACAGGCGTTATAATTGCAGTTATCGCTTTATTCTGTATA
TGCAAATTTGTCTTTTAGTTTTTCTTCAGATTGCTTCATGGAAAAGCTCAGCCTCAAATCAATGAAACCA
GGATTTAATTATATGGATTACTTGAATCTAAGATTACTTGACAAATGATAATATAATACACTGGAGCTTT
AAACATAGCCAATGTGATTCTAACTCCTTTAAACTCACAGTTAATCATAAACAAGGTTTGACATCAATCT
AGTTATCTCTTTGAGAATGATAAACTTGATGAAGATTAAGAAAAAGGTAATCTTTCGATTATCTTTAATC
TTCATCCTTGATTCTACAATCATGACAGTTGTCTTTAGTGACAAGGGAAAGAAGCCTTTTTATTAAGTTG
TAATAATCAGATCTGCGAACCGGTAGAGTTTAGTTGCAACCTAACACACATAAAGCATTGGTCAAAAAGT
CAATAGAAATTTAAACAGTGAGTGGAGACAACTTTTAAATGGAAGCTTCATATGAGAGAGGACGCCCACG
AGCTGCCAGACAGCATTCAAGGGATGGACACGACCACCATGTTCGAGCACGATCATCATCCAGAGAGAAT
TATCGAGGTGAGTACCGTCAATCAAGGAGCGCCTCACAAGTGCGCGTTCCTACTGTATTTCATAAGAAGA
GAGTTGAACCATTAACAGTTCCTCCAGCACCTAAAGACATATGTCCGACCTTGAAAAAAGGATTTTTGTG
TGACAGTAGTTTTTGCAAAAAAGATCACCAGTTGGAGAGTTTAACTGATAGGGAATTACTCCTACTAATC
GCCCGTAAGACTTGTGGATCAGTAGAACAACAATTAAATATAACTGCACCCAAGGACTCGCGCTTAGCAA
ATCCAACGGCTGATGATTTCCAGCAAGAGGAAGGTCCAAAAATTACCTTGTTGACACTGATCAAGACGGC
AGAACACTGGGCGAGACAAGACATCAGAACCATAGAGGATTCAAAATTAAGAGCATTGTTGACTCTATGT
GCTGTGATGACGAGGAAATTCTCAAAATCCCAGCTGAGTCTTTTATGTGAGACACACCTAAGGCGCGAGG
GGCTTGGGCAAGATCAGGCAGAACCCGTTCTCGAAGTATATCAACGATTACACAGTGATAAAGGAGGCAG
TTTTGAAGCTGCACTATGGCAACAATGGGACCGACAATCCCTAATTATGTTTATCACTGCATTCTTGAAT
ATTGCTCTCCAGTTACCGTGTGAAAGTTCTGCTGTCGTTGTTTCAGGGTTAAGAACATTGGTTCCTCAAT
CAGATAATGAGGAAGCTTCAACCAACCCGGGGACATGCTCATGGTCTGATGAGGGTACCCCTTAATAAGG
CTGACTAAAACACTATATAACCTTCTACTTGATCACAATACTCCGTATACCTATCATCATATATTTAATC
AAGACGATATCCTTTAAAACTTATTCAGTACTATAATCACTCTCGTTTCAAATTAATAAGATGTGCATGA
TTGCCCTAATATATGAAGAGGTATGATACAACCCTAACAGTGATCAAAGAAAATCATAATCTCGTATCGC
TCGTAATATAACCTGCCAAGCATACCTCTTGCACAAAGTGATTCTTGTACACAAATAATGTTTTACTCTA
CAGGAGGTAGCAACGATCCATCCCATCAAAAAATAAGTATTTCATGACTTACTAATGATCTCTTAAAATA
TTAAGAAAAACTGACGGAACATAAATTCTTTATGCTTCAAGCTGTGGAGGAGGTGTTTGGTATTGGCTAT
TGTTATATTACAATCAATAACAAGCTTGTAAAAATATTGTTCTTGTTTCAAGAGGTAGATTGTGACCGGA
AATGCTAAACTAATGATGAAGATTAATGCGGAGGTCTGATAAGAATAAACCTTATTATTCAGATTAGGCC
CCAAGAGGCATTCTTCATCTCCTTTTAGCAAAGTACTATTTCAGGGTAGTCCAATTAGTGGCACGTCTTT
TAGCTGTATATCAGTCGCCCCTGAGATACGCCACAAAAGTGTCTCTAAGCTAAATTGGTCTGTACACATC
CCATACATTGTATTAGGGGCAATAATATCTAATTGAACTTAGCCGTTTAAAATTTAGTGCATAAATCTGG
GCTAACACCACCAGGTCAACTCCATTGGCTGAAAAGAAGCTTACCTACAACGAACATCACTTTGAGCGCC
CTCACAATTAAAAAATAGGAACGTCGTTCCAACAATCGAGCGCAAGGTTTCAAGGTTGAACTGAGAGTGT
CTAGACAACAAAATATTGATACTCCAGACACCAAGCAAGACCTGAGAAAAAACCATGGCTAAAGCTACGG
GACGATACAATCTAATATCGCCCAAAAAGGACCTGGAGAAAGGGGTTGTCTTAAGCGACCTCTGTAACTT
CTTAGTTAGCCAAACTATTCAGGGGTGGAAGGTTTATTGGGCTGGTATTGAGTTTGATGTGACTCACAAA
GGAATGGCCCTATTGCATAGACTGAAAACTAATGACTTTGCCCCTGCATGGTCAATGACAAGGAATCTCT
TTCCTCATTTATTTCAAAATCCGAATTCCACAATTGAATCACCGCTGTGGGCATTGAGAGTCATCCTTGC
AGCAGGGATACAGGACCAGCTGATTGACCAGTCTTTGATTGAACCCTTAGCAGGAGCCCTTGGTCTGATC
TCTGATTGGCTGCTAACAACCAACACTAACCATTTCAACATGCGAACACAACGTGTCAAGGAACAATTGA
GCCTAAAAATGCTGTCGTTGATTCGATCCAATATTCTCAAGTTTATTAACAAATTGGATGCTCTACATGT
CGTGAACTACAACGGATTGTTGAGCAGTATTGAAATTGGAACTCAAAATCATACAATCATCATAACTCGA
ACTAACATGGGTTTTCTGGTGGAGCTCCAAGAACCCGACAAATCGGCAATGAACCGCATGAAGCCTGGGC
CGGCGAAATTTTCCCTCCTTCATGAGTCCACACTGAAAGCATTTACACAAGGATCCTCGACACGAATGCA
AAGTTTGATTCTTGAATTTAATAGCTCTCTTGCTATCTAACTAAGGTAGAATACTTCATATTGAGCTAAC
TCATATATGCTGACTCAATAGTTATCTTGACATCTCTGCTTTCATAATCAGATATATAAGCATAATAAAT
AAATACTCATATTTCTTGATAATTTGTTTAACCACAGATAAATCCTCACTGTAAGCCAGCTTCCAAGTTG
ACACCCTTACAAAAACCAGGACTCAGAATCCCTCAAACAAGAGATTCCAAGACAACATCATAGAATTGCT
TTATTATATGAATAAGCATTTTATCACCAGAAATCCTATATACTAAATGGTTAATTGTAACTGAACCCGC
AGGTCACATGTGTTAGGTTTCACAGATTCTATATATTACTAACTCTATACTCGTAATTAACATTAGATAA
GTAGATTAAGAAAAAAGCCTGAGGAAGATTAAGAAAAACTGCTTATTGGGTCTTTCCGTGTTTTAGATGA
AGCAGTTGAAATTCTTCCTCTTGATATTAAATGGCTACACAACATACCCAATACCCAGACGCTAGGTTAT
CATCACCAATTGTATTGGACCAATGTGACCTAGTCACTAGAGCTTGCGGGTTATATTCATCATACTCCCT
TAATCCGCAACTACGCAACTGTAAACTCCCGAAACATATCTACCGTTTGAAATACGATGTAACTGTTACC
AAGTTCTTGAGTGATGTACCAGTGGCGACATTGCCCATAGATTTCATAGTCCCAGTTCTTCTCAAGGCAC
TGTCAGGCAATGGATTCTGTCCTGTTGAGCCGCGGTGCCAACAGTTCTTAGATGAAATCATTAAGTACAC
AATGCAAGATGCTCTCTTCTTGAAATATTATCTCAAAAATGTGGGTGCTCAAGAAGACTGTGTTGATGAA
CACTTTCAAGAGAAAATCTTATCTTCAATTCAGGGCAATGAATTTTTACATCAAATGTTTTTCTGGTATG
ATCTGGCTATTTTAACTCGAAGGGGTAGATTAAATCGAGGAAACTCTAGATCAACATGGTTTGTTCATGA
TGATTTAATAGACATCTTAGGCTATGGGGACTATGTTTTTTGGAAGATCCCAATTTCAATGTTACCACTG
AACACACAAGGAATCCCCCATGCTGCTATGGACTGGTATCAGGCATCAGTATTCAAAGAAGCGGTTCAAG
GGCATACACACATTGTTTCTGTTTCTACTGCCGACGTCTTGATAATGTGCAAAGATTTAATTACATGTCG
ATTCAACACAACTCTAATCTCAAAAATAGCAGAGATTGAGGATCCAGTTTGTTCTGATTATCCCAATTTT
AAGATTGTGTCTATGCTTTACCAGAGCGGAGATTACTTACTCTCCATATTAGGGTCTGATGGGTATAAAA
TTATTAAGTTCCTCGAACCATTGTGCTTGGCCAAAATTCAATTATGCTCAAAGTACACTGAGAGGAAGGG
CCGATTCTTAACACAAATGCATTTAGCTGTAAATCACACCCTAGAAGAAATTACAGAAATGCGTGCACTA
AAGCCTTCACAGGCTCAAAAGATCCGTGAATTCCATAGAACATTGATAAGGCTGGAGATGACGCCACAAC
AACTTTGTGAGCTATTTTCCATTCAAAAACACTGGGGGCATCCTGTGCTACATAGTGAAACAGCAATCCA
AAAAGTTAAAAAACATGCTACGGTGCTAAAAGCATTACGCCCTATAGTGATTTTCGAGACATACTGTGTT
TTTAAATATAGTATTGCCAAACATTATTTTGATAGTCAAGGATCTTGGTACAGTGTTACTTCAGATAGGA
ATCTAACACCGGGTCTTAATTCTTATATCAAAAGAAATCAATTCCCTCCGTTGCCAATGATTAAAGAACT
ACTATGGGAATTTTACCACCTTGACCACCCTCCACTTTTCTCAACCAAAATTATTAGTGACTTAAGTATT
TTTATAAAAGACAGAGCTACCGCAGTAGAAAGGACATGCTGGGATGCAGTATTCGAGCCTAATGTTCTAG
GATATAATCCACCTCACAAATTTAGTACTAAACGTGTACCGGAACAATTTTTAGAGCAAGAAAACTTTTC
TATTGAGAATGTTCTTTCCTACGCACAAAAACTCGAGTATCTACTACCACAATATCGGAACTTTTCTTTC
TCATTGAAAGAGAAAGAGTTGAATGTAGGTAGAACCTTCGGAAAATTGCCTTATCCGACTCGCAATGTTC
AAACACTTTGTGAAGCTCTGTTAGCTGATGGTCTTGCTAAAGCATTTCCTAGCAATATGATGGTAGTTAC
GGAACGTGAGCAAAAAGAAAGCTTATTGCATCAAGCATCATGGCACCACACAAGTGATGATTTTGGTGAA
CATGCCACAGTTAGAGGGAGTAGCTTTGTAACTGATTTAGAGAAATACAATCTTGCATTTAGATATGAGT
TTACAGCACCTTTTATAGAATATTGCAACCGTTGCTATGGTGTTAAGAATGTTTTTAATTGGATGCATTA
TACAATCCCACAGTGTTATATGCATGTCAGTGATTATTATAATCCACCACATAACCTCACACTGGAGAAT
CGAGACAACCCCCCCGAAGGGCCTAGTTCATACAGGGGTCATATGGGAGGGATTGAAGGACTGCAACAAA
AACTCTGGACAAGTATTTCATGTGCTCAAATTTCTTTAGTTGAAATTAAGACTGGTTTTAAGTTACGCTC
AGCTGTGATGGGTGACAATCAGTGCATTACTGTTTTATCAGTCTTCCCCTTAGAGACTGACGCAGACGAG
CAGGAACAGAGCGCCGAAGACAATGCAGCGAGGGTGGCCGCCAGCCTAGCAAAAGTTACAAGTGCCTGTG
GAATCTTTTTAAAACCTGATGAAACATTTGTACATTCAGGTTTTATCTATTTTGGAAAAAAACAATATTT
GAATGGGGTCCAATTGCCTCAGTCCCTTAAAACGGCTACAAGAATGGCACCATTGTCTGATGCAATTTTT
GATGATCTTCAAGGGACCCTGGCTAGTATAGGCACTGCTTTTGAGCGATCCATCTCTGAGACACGACATA
TCTTTCCTTGCAGGATAACCGCAGCTTTCCATACGTTTTTTTCGGTGAGAATCTTGCAATATCATCATCT
CGGGTTCAATAAAGGTTTTGACCTTGGACAGTTAACACTCGGCAAACCTCTGGATTTCGGAACAATATCA
TTGGCACTAGCGGTACCGCAGGTGCTTGGAGGGTTATCCTTCTTGAATCCTGAGAAATGTTTCTACCGGA
ATCTAGGAGATCCAGTTACCTCAGGCTTATTCCAGTTAAAAACTTATCTCCGAATGATTGAGATGGATGA
TTTATTCTTACCTTTAATTGCGAAGAACCCTGGGAACTGCACTGCCATTGACTTTGTGCTAAATCCTAGC
GGATTAAATGTCCCTGGGTCGCAAGACTTAACTTCATTTCTGCGCCAGATTGTACGCAGGACCATCACCC
TAAGTGCGAAAAACAAACTTATTAATACCTTATTTCATGCGTCAGCTGACTTCGAAGACGAAATGGTTTG
TAAATGGCTATTATCATCAACTCCTGTTATGAGTCGTTTTGCGGCCGATATCTTTTCACGCACGCCGAGC
GGGAAGCGATTGCAAATTCTAGGATACCTGGAAGGAACACGCACATTATTAGCCTCTAAGATCATCAACA
ATAATACAGAGACACCGGTTTTGGACAGACTGAGGAAAATAACATTGCAAAGGTGGAGCCTATGGTTTAG
TTATCTTGATCATTGTGATAATATCCTGGCGGAGGCTTTAACCCAAATAACTTGCACAGTTGATTTAGCA
CAGATTCTGAGGGAATATTCATGGGCTCATATTTTAGAGGGAAGACCTCTTATTGGAGCCACACTCCCAT
GTATGATTGAGCAATTCAAAGTGTTTTGGCTGAAACCCTACGAACAATGTCCGCAGTGTTCAAATGCAAA
GCAACCAGGTGGGAAACCATTCGTGTCAGTGGCAGTCAAGAAACATATTGTTAGTGCATGGCCGAACGCA
TCCCGAATAAGCTGGACTATCGGGGATGGAATCCCATACATTGGATCAAGGACAGAAGATAAGATAGGAC
AACCTGCTATTAAACCAAAATGTCCTTCCGCAGCCTTAAGAGAGGCCATTGAATTGGCGTCCCGTTTAAC
ATGGGTAACTCAAGGCAGTTCGAACAGTGACTTGCTAATAAAACCATTTTTGGAAGCACGAGTAAATTTA
AGTGTTCAAGAAATACTTCAAATGACCCCTTCACATTACTCAGGAAATATTGTTCACAGGTACAACGATC
AATACAGTCCTCATTCTTTCATGGCCAATCGTATGAGTAATTCAGCAACGCGATTGATTGTTTCTACAAA
CACTTTAGGTGAGTTTTCAGGAGGTGGCCAGTCTGCACGCGACAGCAATATTATTTTCCAGAATGTTATA
AATTATGCAGTTGCACTGTTCGATATTAAATTTAGAAACACTGAGGCTACAGATATCCAATATAATCGTG
CTCACCTTCATCTAACTAAGTGTTGCACCCGGGAAGTACCAGCTCAGTATTTAACATACACATCTACATT
GGATTTAGATTTAACAAGATACCGAGAAAACGAATTGATTTATGACAGTAATCCTCTAAAAGGAGGACTC
AATTGCAATATCTCATTCGATAATCCATTTTTCCAAGGTAAACGGCTGAACATTATAGAAGATGATCTTA
TTCGACTGCCTCACTTATCTGGATGGGAGCTAGCCAAGACCATCATGCAATCAATTATTTCAGATAGCAA
CAATTCATCTACAGACCCAATTAGCAGTGGAGAAACAAGATCATTCACTACCCATTTCTTAACTTATCCC
AAGATAGGACTTCTGTACAGTTTTGGGGCCTTTGTAAGTTATTATCTTGGCAATACAATTCTTCGGACTA
AGAAATTAACACTTGACAATTTTTTATATTACTTAACTACTCAAATTCATAATCTACCACATCGCTCATT
GCGAATACTTAAGCCAACATTCAAACATGCAAGCGTTATGTCACGGTTAATGAGTATTGATCCTCATTTT
TCTATTTACATAGGCGGTGCTGCAGGTGACAGAGGACTCTCAGATGCGGCCAGGTTATTTTTGAGAACGT
CCATTTCATCTTTTCTTACATTTGTAAAAGAATGGATAATTAATCGCGGAACAATTGTCCCTTTATGGAT
AGTATATCCGCTAGAGGGTCAAAACCCAACACCTGTGAATAATTTTCTCTATCAGATCGTAGAACTGCTG
GTGCATGATTCATCAAGACAACAGGCTTTTAAAACTACCATAAGTGATCATGTACATCCTCACGACAATC
TTGTTTACACATGTAAGAGTACAGCCAGCAATTTCTTCCATGCATCATTGGCGTACTGGAGGAGCAGACA
CAGAAACAGCAACCGAAAATACTTGGCAAGAGACTCTTCAACTGGATCAAGCACAAACAACAGTGATGGT
CATATTGAGAGAAGTCAAGAACAAACCACCAGAGATCCACATGATGGCACTGAACGGAATCTAGTCCTAC
AAATGAGCCATGAAATAAAAAGAACGACAATTCCACAAGAAAACACGCACCAGGGTCCGTCGTTCCAGTC
CTTTCTAAGTGACTCTGCTTGTGGTACAGCAAATCCAAAACTAAATTTCGATCGATCGAGACACAATGTG
AAATTTCAGGATCATAACTCGGCATCCAAGAGGGAAGGTCATCAAATAATCTCACACCGTCTAGTCCTAC
CTTTCTTTACATTATCTCAAGGGACACGCCAATTAACGTCATCCAATGAGTCACAAACCCAAGACGAGAT
ATCAAAGTACTTACGGCAATTGAGATCCGTCATTGATACCACAGTTTATTGTAGATTTACCGGTATAGTC
TCGTCCATGCATTACAAACTTGATGAGGTCCTTTGGGAAATAGAGAGTTTCAAGTCGGCTGTGACGCTAG
CAGAGGGAGAAGGTGCTGGTGCCTTACTATTGATTCAGAAATACCAAGTTAAGACCTTATTTTTCAACAC
GCTAGCTACTGAGTCCAGTATAGAGTCAGAAATAGTATCAGGAATGACTACTCCTAGGATGCTTCTACCT
GTTATGTCAAAATTCCATAATGACCAAATTGAGATTATTCTTAACAACTCAGCAAGCCAAATAACAGACA
TAACAAATCCTACTTGGTTTAAAGACCAAAGAGCAAGGCTACCTAAGCAAGTCGAGGTTATAACCATGGA
TGCAGAGACAACAGAGAATATAAACAGATCGAAATTGTACGAAGCTGTATATAAATTGATCTTACACCAT
ATTGATCCTAGCGTATTGAAAGCAGTGGTCCTTAAAGTCTTTCTAAGTGATACTGAGGGTATGTTATGGC
TAAATGATAATTTAGCCCCGTTTTTTGCCACTGGTTATTTAATTAAGCCAATAACGTCAAGTGCTAGATC
TAGTGAGTGGTATCTTTGTCTGACGAACTTCTTATCAACTACACGTAAGATGCCACACCAAAACCATCTC
AGTTGTAAACAGGTAATACTTACGGCATTGCAACTGCAAATTCAACGAAGCCCATACTGGCTAAGTCATT
TAACTCAGTATGCTGACTGTGAGTTACATTTAAGTTATATCCGCCTTGGTTTTCCATCATTAGAGAAAGT
ACTATACCACAGGTATAACCTCGTCGATTCAAAAAGAGGTCCACTAGTCTCTATCACTCAGCACTTAGCA
CATCTTAGAGCAGAGATTCGAGAATTAACTAATGATTATAATCAACAGCGACAAAGTCGGACTCAAACAT
ATCACTTTATTCGTACTGCAAAAGGACGAATCACAAAACTAGTCAATGATTATTTAAAATTCTTTCTTAT
TGTGCAAGCATTAAAACATAATGGGACATGGCAAGCTGAGTTTAAGAAATTACCAGAGTTGATTAGTGTG
TGCAATAGGTTCTACCATATTAGAGATTGCAATTGTGAAGAACGTTTCTTAGTTCAAACCTTATATTTAC
ATAGAATGCAGGATTCTGAAGTTAAGCTTATCGAAAGGCTGACAGGGCTTCTGAGTTTATTTCCGGATGG
TCTCTACAGGTTTGATTGAATTACCGTGCATAGTATCCTGATACTTGCAAAGGTTGGTTATTAACATACA
GATTATAAAAAACTCATAAATTGCTCTCATACATCATATTGATCTAATCTCAATAAACAACTATTTAAAT
AACGAAAGGAGTCCCTATATTATATACTATATTTAGCCTCTCTCCCTGCGTGATAATCAAAAAATTCACA
ATGCAGCATGTGTGACATATTACTGCCGCAATGAATTTAACGCAACATAATAAACTCTGCACTCTTTATA
ATTAAGCTTTAACGAAAGGTCTGGGCTCATATTGTTATTGATATAATAATGTTGTATCAATATCCTGTCA
GATGGAATAGTGTTTTGGTTGATAACACAACTTCTTAAAACAAAATTGATCTTTAAGATTAAGTTTTTTA
TAATTATCATTACTTTAATTTGTCGTTTTAAAAACGGTGATAGCCTTAATCTTTGTGTAAAATAAGAGAT
TAGGTGTAATAACCTTAACATTTTTGTCTAGTAAGCTACTATTTCATACAGAATGATAAAATTAAAAGAA
AAGGCAGGACTGTAAAATCAGAAATACCTTCTTTACAATATAGCAGACTAGATAATAATCTTCGTGTTAA
TGATAATTAAGACATTGACCACGCTCATCAGAAGGCTCGCCAGAATAAACGTTGCAAAAAGGATTCCTGG
AAAAATGGTCGCACACAAAAATTTAAAAATAAATCTATTTCTTCTTTTTTGTGTGTCCA
Subscribe to:
Posts (Atom)